NEET 2023 – PYQ Practice

Given below are two statements: Statement I : Photovoltaic devices can convert optical radiation into electricity. Statement II : Zener diode is designed to operate under reverse bias in breakdown region. In the light of the above statements, choose the most appropriate answer from the options given below :

The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :

The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is

The net magnetic flux through any closed surface is :

For Young's double slit experiment, two statements are given below : Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains constant. Statement II : If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases. In the light of the above statements, choose the correct answer from the options given below :

An ac source is connected to a capacitor C. Due to decrease in its operating frequency

The venturi-meter works on :

A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?

A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :

The angular acceleration of a body, moving along the circumference of a circle, is :

The element expected to form largest ion to achieve the nearest noble gas configuration is

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : A reaction can have zero activation energy. Reason R : The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy. In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements: Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside Statement II : When nucleoside is linked to phosphorous acid at 5' position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below:

Taking stability as the factor, which one of the following represents correct relationship?

Intermolecular forces are forces of attraction and repulsion between interacting particles that will include: A. dipole - dipole forces. B. dipole - induced dipole forces C. hydrogen bonding D. covalent bonding E. dispersion forces Choose the most appropriate answer from the options given below :

Amongst the given options which of the following molecules/ion acts as a Lewis acid?

Which of the following reactions will NOT give primary amine as the product?

Homoleptic complex from the following complexes is :

Which amongst the following will be most readily dehydrated under acidic conditions?

Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?

Which complex compound is most stable?

Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?

Identify the pair of heterosporous pteridophytes among the following :

Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

What is the function of tassels in the corn cob?

Identify the correct statements : A. Detrivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below :

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Late wood has fewer xylary elements with narrow vessels. Reason R : Cambium is less active in winters. In the light of the above statements, choose the correct answer from the options given below :

The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?

Which of the following stages of meiosis involves division of centromere?

During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.

Large, colourful, fragrant flowers with nectar are seen in

Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period, that leads early seed production?

Among eukaryotes, replication of DNA takes place in :

In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.

Unequivocal proof that DNA is the genetic material was first proposed by

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :

The phenomenon of pleiotropism refers to

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1, 6-diphosphate. In the light of the above statements, choose the correct answer from the options given below :

Cellulose does not form blue colour with Iodine because

Which hormone promotes internode/petiole elongation in deep water rice?

Expressed Sequence Tags (ESTs) refers to

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year

The reaction centre in PS II has an absorption maxima at

Given below are two statements : One labelled as Assertion A and the other labelled as Reason R: Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R : Protonema develops directly from spores produced in capsule. In the light of the above statements, choose the most appropriate answer from options given below:

In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as

Given below are two statements : Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II : Exarch condition is the most common feature of the root system. In the light of the above statements, choose the correct answer from the options given below:

Which of the following statements are correct about Klinefelter’s Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine development is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below :

Given below are two statements: Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. Statement II : In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below:

How many different proteins does the ribosome consist of?

Which of the following combinations is required for chemiosmosis?

Which one of the following statements is NOT correct?

Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell B. Cutting of DNA at specific location by restriction enzyme C. Isolation of desired DNA fragment D. Amplification of gene of interest using PCR Choose the correct answer from the options given below :

Given below are two statements : One labelled as Assertion A and the other labelled as Reason R : Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. In the light of the above statements, choose the correct answer from the options given below :

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem. Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive node instead of leaves. In the light of the above statements, choose the correct answer from the options given below :

Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of

Radial symmetry is NOT found in adults of phylum ______.

Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and is called menopause. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic menstruation extends between menarche and menopause. Choose the most appropriate answer from the options given below:

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla. Reason R : Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. In the light of the above statements, choose the correct answer from the options given below :

Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below:

Broad palm with single palm crease is visible in a person suffering from-

Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Endometrium is necessary for implantation of blastocyst. Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. In the light of the above statements, choose the correct answer from the options given below:

Which of the following is not a cloning vector?

Given below are two statements: Statement I : Ligaments are dense irregular tissue. Statement II : Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below:

Which of the following functions is carried out by cytoskeleton in a cell?

Which one of the following symbols represents mating between relatives in human pedigree analysis?

Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?

Given below are two statements : Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements: Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement Il: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below:

In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?

Vital capacity of lung is ________.

Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.

Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R. Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. Reason R : Ban on amniocentesis checks increasing menace of female foeticide. In the light of the above statements, choose the correct answer from the options given below.

Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs B. Basophils secrete histamine, serotonin and heparin C. Basophils are involved in inflammatory response D. Basophils have kidney shaped nucleus E. Basophils are agranulocytes Choose the correct answer from the options given below:

Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:

In cockroach, excretion is brought about by - A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands Choose the correct answer from the options given below :

Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gill slits. D. Presence of dorsal heart E. Triploblastic pseudocoelomate animals. Choose the correct answer from the options given below:

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

Which of the following is characteristic feature of cockroach regarding sexual dimorphism?

Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below:

The unique mammalian characteristics are :

The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are:

Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR. Choose the correct answer from the options given below:

Which of the following are NOT under the control of thyroid hormone? A. Maintenance of water and electrolyte balance B. Regulation of basal metabolic rate C. Normal rhythm of sleep-wake cycle D. Development of immune system E. Support the process of RBCs formation Choose the correct answer from the options given below: